HiSeq100 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq100
Unique NameHiSeq100
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length519
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq100 ID=HiSeq100|Name=HiSeq100|organism=Ostrinia scapulalis|type=mRNA|length=519bp
TGTTGGAGAGGATTCTTATCTTTGAAGGATTAGCAGTGATAGAAATCATA
TTGATGTCAGAATCTTCAAACCTATTGGTGATATCAGTCAGTAAGGAACT
TTGTCTTTTGGTGACACTCAGGGGAACCACTTGGTTGTCATCAACGGAGG
AAGCTTCATGATATTGTGACATTTTTAGAAAACCTAGATGTTTTCCGTGA
GTACATATGACTCCACAGTCACATTCAAAACAACTCAATTTGCGAAATGT
TAGGTTCACAACATCTTTTCTCCATAACACTTGGTGTACATCGAAGGTGC
CTCTAAATGTCGGTAAATTCTTTGGCATTGCACTTTCTCTCTTGGCTATA
TTTTCCTCAGGCACATCAAACATGACGACGTTTTTTACATTTTCTTTAAC
CAAACGCAAGAACTTGTCATATGTACCCACATCTTCACCGTGATTAACAC
AGGAATCCACAGTCCTTTTTATTGTAGCTCCTACACCGTCCGGGGCTCCT
TTGCCATGTCCGGCCTCAG
back to top