HiSeq10000 (mRNA) Ostrinia scapulalis

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameHiSeq10000
Unique NameHiSeq10000
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length255
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Relationships

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
HiSeq10000HiSeq10000_pOstrinia scapulalispolypeptide?


Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10000 ID=HiSeq10000|Name=HiSeq10000|organism=Ostrinia scapulalis|type=mRNA|length=255bp
TTTTTATAATCATGTTCCAAAATATACCCTTAACAATGCGAATGAAGACT
GTCCTTAACCAAAATCCTGTATACTTTCAGGTTCTTAAAAATCCAAGTAA
TATAAACAAGTTTTCTTCAGATTTCACCATTATCTTGAATGTTGTATCTT
CTTGCAAAGGATGTCCATAGCTTGCTGCAGCAATGTAGAGTTGTCGCAGG
TCAGCATTAGCTATAAGATAATCTTAATGCATAGTATGTGTTTATTAAGC
AACCC
back to top

protein sequence of HiSeq10000

>HiSeq10000_p ID=HiSeq10000_p|Name=HiSeq10000|organism=Ostrinia scapulalis|type=polypeptide|length=43bp
MLTCDNSTLLQQAXGHPLQEDTTFKIMVKSEENLFILLGFLRT
back to top