HiSeq10005 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10005
Unique NameHiSeq10005
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length467
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10005 ID=HiSeq10005|Name=HiSeq10005|organism=Ostrinia scapulalis|type=mRNA|length=467bp
ATATTAGACTCGTATTTTTTATTTCTCGTTTTATACTCGTATTCTTTCAT
AAATTAAATAATAACAGGCTACATCGAGTTGAAATGGGTTTTTTGTAGAA
AATATAGCTTTTGGCACTTTGGAACTCGGAATTATACGATTTCTTACTCA
AAAAAGGCCAATATAAAAATTTGGGTTCAGTCAGAAAAAAGACGATGGCA
AAAATAGCATAGCACCACTTAATCTATATTTTTATATGAAGTATTAATAT
TTAATACCTCTTCTGTATAAAATCTATGTTTCACAATAATAATTTTATGA
TTTTTTAAATTCTGAAAGAGCGTAGGGTGCGGTATAAGGAATTTGTGTTT
TGTTCTTTCATGTTAAAATTCTTTGTTAAACAGGTCAATTCTTCCCATGT
CAAAGTGTCAATATAGATGAACTACAACGAACTGTTCCACACTTGACATT
GACAGGGGGCGCCACCG
back to top