HiSeq10007 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10007
Unique NameHiSeq10007
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length627
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10007 ID=HiSeq10007|Name=HiSeq10007|organism=Ostrinia scapulalis|type=mRNA|length=627bp
TTTACAGCAGGTAATACTTCTTAATTTTTTTGTCAACTGGTTAGTACAAC
AGTGGAGTTTTTATATGGAGTTAAGATTTGAATTCTATAGCTTAAGCGCT
GAAACTTGTTACTGTTTTTCTAAAGGATGAAGTAAAGAATAAGTTAAATT
TAAATACACACAATAACAGGTATGTTACTCATATTGTAAGTCTATAGAAA
AGTCAAGTTATTGCACTTTAACAATATGTCAGTCTAAACCTAAATGCATA
CAACTAACACAGTTTGTTGTCTTGTATACCTTTCTTAACCCTTTCTAAAC
CTTTTATTAGTTTGCTTTAAGCAAGTTACTTAGGATTTGATATTATAAGT
AAATGCTGCTACTAACGAATCATATCATGGTTTTATTTTCAAAACCTTGC
AGTTCTATGGTAAGTGTATAATTCAAAATTCGTTCATGTTCCTTACATTA
GAAGACTCATTTTATAAATTGGCCTCCAAACTTCCACCATAACGCACTGT
CACCAACTTTTCGATTCTATCATAGACTATTTTCTGCTGCACAATCTAAT
TGGTTTTTAGGCTAAAGTCCGGTCATCGTAATTATATTGCTGTCGCGCTC
ACACACTGCGGCTGCCCGTCGCACAGT
back to top