HiSeq10009 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10009
Unique NameHiSeq10009
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length246
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10009 ID=HiSeq10009|Name=HiSeq10009|organism=Ostrinia scapulalis|type=mRNA|length=246bp
TTTTGCGGCATCTGCTCTCGAAGGTCTGTAAAATTGGAAATTTTATTTTT
GTCTTATTTCCTATCAGGAGAAAATCAACTAAATCAACATTGAGCAAACA
CCACAGACATGCGGGAGCATGCCAAGCCTAGTTCCAGGGAGGGGACTACA
CAGTGCGCATATTTAGACGAACCAATCAGAGCCACTCTTGACTCCTCATC
ATTCAAAAACCGCTGTGCATCAACACTTCAAATTTGGCTCATGTGC
back to top