HiSeq1001 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1001
Unique NameHiSeq1001
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length245
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1001 ID=HiSeq1001|Name=HiSeq1001|organism=Ostrinia scapulalis|type=mRNA|length=245bp
GATGCATTTTCTAGGGCCATCGAACATCGCGACAAGGAATGCAATAGTTC
AAACATCTTATCATTCATTGAATGTATATGCTCGATAGTTTTAATTTTTT
TAACCATAATAATACTTAACAATAAAGTTACTGGGACATCTTTAAAGACA
AAACCATACTGCGTTAAGGTATGCATTGATGAATGAAAAATTCGAAGGAC
TTTTTATAGTTGATGTTTAATTATTGTGTTCGTTGTCGCGCGAAT
back to top