HiSeq10011 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10011
Unique NameHiSeq10011
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length257
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10011 ID=HiSeq10011|Name=HiSeq10011|organism=Ostrinia scapulalis|type=mRNA|length=257bp
TTTTGCGGCATCTGCTCTCGAAGGTCTGTAAAATTGGAAATTTTATTTTT
GTCTTATTTCCTATCAGGAGAAAATCAACCAAATCAACATTGAGCAAACA
CCACAGACATGCGGGAGCATGCCAAGCCCAGTTCCAGGGAGGGGACTACA
CAGTGCGCATATTTAGACGAACCAATTGTAGCCACTTTTAACTCCTCATC
ATTCAAAAAGTACTGTGCATTAACACCTCAAACCTGGCTCATGTGTTGAG
ACTTGCA
back to top