HiSeq10019 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10019
Unique NameHiSeq10019
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length464
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10019 ID=HiSeq10019|Name=HiSeq10019|organism=Ostrinia scapulalis|type=mRNA|length=464bp
GACATGCTTTCTCGTATGATGTGTATGCTCGAAGCGCGTCGAGAGATGGC
GGGAGTGTAGCCGCGCTGCCTCCCTGCATCGCCGCTAGGGCGGCGTACGA
CTCACGATCACATGGTATCACTTCACTGTATTTTCTTTTTCTATGAACTA
GCGCCTTCCACATCTTGAATTTCGTCTTTTTTGGCCTTTGGAGACTCATT
CACATTGTTTTACACACCTTTCATAGAAACTTTTGTCTATCTTTGAAATT
ATTTGAATGCAAACAATTCCAAAACAGCTGATCAAAACACAATAAAACTG
GCACAGCACAAAGTTTACACTTCACATAAACTTTTTTTAAAAAGTATCGT
GAGCGTTCGATTCTGATTGAATCGCCGTTCGATTTTCAAAAGTTTTGAAA
ATCTTGGCGCGTGTAGCGGATGTGTCGCGACTCGCGGTTCGGAAGCGGCG
CGGTACACTGCGGA
back to top