HiSeq10042 (mRNA) Ostrinia scapulalis

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameHiSeq10042
Unique NameHiSeq10042
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length752
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Relationships

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
HiSeq10042HiSeq10042_pOstrinia scapulalispolypeptide?


Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10042 ID=HiSeq10042|Name=HiSeq10042|organism=Ostrinia scapulalis|type=mRNA|length=752bp
AAAAGAAGAAGAAGAAGAAGTTTTTGGTTTTCGTCTTTTTGTAATTTTCC
ATTAAAAAATTGGTGAAAGCCAAAATTATTTCAGCAAAATCAAATACAAT
ACAATTTAACTAACATGGAAAGTTCCAGTTCAGCGAGTCCAGAAGACACA
AATACTGTTAGACTTCTCGCTAAAGGTGTTCTAGAACTATACGAACCCCC
GTTAGCTACAATCAACACGCATCTCAAAGAATTAACAGAAAAACAAGAAA
CAGTCCAACTGATGCTGACCTCCGAGAGAAGGAAGCTCGAAGACCTTCAG
AATGATGCCTCATTGGATGCTTTGTTGGCAGATATAGCAACAAACAGGGA
AAAGTTAACATCCATTTCCAGTACAATGATGAACTTGCATAAAAGAGTAC
AATCCTTGCAGACTCGTGCAGCAAATATAGAAAAAGCAGCAAAATCTCGT
GCTACTGGTGTAGGCCGGCCAACTAGTAGTTAGAAGTTTTAGTTTATTTA
TTAAGTACTTTAAGCTCTAAAATATAAGATGCAATTTACACAAACAGTCC
ATAGTTGTCGGCGAAAAAGGTTTAAGCGACATCTTTTCCGTAAATGCCGA
CATTAAGCCCAGTGTCGGCATTGTAACTTACAACAAGATTGTCGGTGTAA
ATAGTAATGCAACATCGATATAGTAAACGCCGACAGTAAGTCTACTGGCA
GCATTGGTAAGTATCGGTAGGTATTCGGCAGCCACGGTGAATAGGGAGGG
AT
back to top

protein sequence of HiSeq10042

>HiSeq10042_p ID=HiSeq10042_p|Name=HiSeq10042|organism=Ostrinia scapulalis|type=polypeptide|length=122bp
MESSSSASPEDTNTVRLLAKGVLELYEPPLATINTHLKELTEKQETVQLM
LTSERRKLEDLQNDASLDALLADIATNREKLTSISSTMMNLHKRVQSLQT
RAANIEKAAKSRATGVGRPTSS
back to top