HiSeq10043 (mRNA) Ostrinia scapulalis

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameHiSeq10043
Unique NameHiSeq10043
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length761
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Relationships

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
HiSeq10043HiSeq10043_pOstrinia scapulalispolypeptide?


Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10043 ID=HiSeq10043|Name=HiSeq10043|organism=Ostrinia scapulalis|type=mRNA|length=761bp
AAAAGAAGAAGAAGAAGAAGTTTTTGGTTTTCGTCTTTTTGTAATTTTCC
ATTAAAAAATTGGTGAAAGCCAAAATTATTTCAGCAAAATCAAATACAAT
ACAATTTAACTAACATGGAAAGTTCCAGTTCAGCGAGTCCAGAAGACACA
AATACTGTTAGACTTCTCGCTAAAGGTGTTCTAGAACTATACGAACCCCC
GTTAGCTACAATCAACACGCATCTCAAAGAATTAACAGAAAAACAAGAAA
CAGTCCAACTGATGCTGACCTCCGAGAGAAGGAAGCTCGAAGACCTTCAG
AATGATGCCTCATTGGATGCTTTGTTGGCAGATATAGCAACAAACAGGGA
AAAGTTAACATCCATTTCCAGTACAATGATGAACTTGCATAAAAGAGTAC
AATCCTTGCAGACTCGTGCAGCAAATATAGAAAAGGCAGCAAAATCTCGT
GCTACTAGTGTAGGCCGGCCAACTAGTAGTTAGAAGTTTTAGTTTATTTA
TTAAGTACTTTAAGCTCTAAAATATAAGATGCAATTTACACAAACAGTCC
TTTTTCGCCGACAACTAGTCGGCAAAAAGGTTAGGCGACGTTTTTTCAGT
AAATGTCGACATTAAGCCCAGTGTCAGCATTATAACTTACAACAAGATTG
TCGGTGTAAATAGTTATGCAACATCGATAAAGTAAACTCCGATAGTAAGT
CTATTGGCAGCATTGGTAAGTATCGGTAGGTATTCGGCAGCCACGGTGAA
TAGGGAGGGAT
back to top

protein sequence of HiSeq10043

>HiSeq10043_p ID=HiSeq10043_p|Name=HiSeq10043|organism=Ostrinia scapulalis|type=polypeptide|length=122bp
MESSSSASPEDTNTVRLLAKGVLELYEPPLATINTHLKELTEKQETVQLM
LTSERRKLEDLQNDASLDALLADIATNREKLTSISSTMMNLHKRVQSLQT
RAANIEKAAKSRATSVGRPTSS
back to top