HiSeq10045 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10045
Unique NameHiSeq10045
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length613
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10045 ID=HiSeq10045|Name=HiSeq10045|organism=Ostrinia scapulalis|type=mRNA|length=613bp
GTCTTAAATCACTAAAGTTTAAAACAATAAATAACTTAGTACTAAATAAA
TTAAATTAAAACCGTTAATTTTCAAGATCTATTTTCAATTTTGTATATTT
TCTAAGGCTTTTTGATTTTTGCGTTTGAAATATTTCAAATGCAAAAGCAT
TATAGGAATTGAAACCCCAAACAAACTCATGAATAATGCATTTCAACAAA
ATGGAGCATTGGTTACGTATGAACAAATTGATATTATTTTGTGACATTAA
GTCTTTAAAACACTATTCTAGTGTATCTTTTATCCATTTCCTATTATGAA
ATAAATAATTGTATTAAATAACTATTCCTAAATGTCGTCATAATATTGCA
AAAGCAAAGGCTCGCTAAGCATAGTTTTCAACGTATTAGCTAATTAAGAT
TAAAAAGACTCAAAATATAAAATAAATAAAAAGCACAACACAAATTATCG
TAAACTAAGGGACAAATAAAAACAAATGTAAAGTCCCATCACAGCTTACG
TGTCTAATGGTAAAATTACAATAACCCTAAATCACGAAGTGGGCGTGACT
TCCATTACTGTGTCTGGTTTGAAACCGGTTTGAAATGGTCCGTCATGTGT
GGTCTCTCAACGG
back to top