HiSeq1005 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1005
Unique NameHiSeq1005
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length388
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1005 ID=HiSeq1005|Name=HiSeq1005|organism=Ostrinia scapulalis|type=mRNA|length=388bp
AAGAGTGATGGTCGTTATCAACCTACAAAGAAAAATGTATAAACCCAGAG
ATCGTGTATTTGATTTCAATATACATTTTTACTAATTCAATATTGTTATA
TTTTTCGTTCAAGTTGCGTAGTGTGGAATTCTAAATTATTTGCAAAAATA
AAAGTTCAGAGCTCTTTCCTACGGAGGTATCCCGTTTTTTGCAGGATATA
CGTGTTTTTATATTAACTGTCACACAAACATCCCGTTCGCAGTATCCCGC
AAAAAACCAATCCATTCGAATTTCAAACTCACACTTGTGGATTGCATTAC
TTATTGGATCCCGTAAAACGGGATTGTCATGGGAATGGGCTCTAAGGCCC
CTCGCCCACGGCGGCTTTTTGTAGCGATGCAGTAGCGA
back to top