HiSeq10056 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10056
Unique NameHiSeq10056
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length280
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10056 ID=HiSeq10056|Name=HiSeq10056|organism=Ostrinia scapulalis|type=mRNA|length=280bp
TCATCGATAAAATTGTCCATAGATCACGCACTTAAAGTTTGATCACTACA
TGCTCGGACCACACTGTATAGATATAGATTTAGATAATGTCTCAGGAGAT
AAGATTAAAGTTTATTTCTTGATTATTATTCACCATGAGTGTGTGATTGT
GATTGCTGATATTATTATAGCTGATATAAGTAATACTCTATAATTATTAA
TACTAATGTAGGGTTTCAACGCAATAATTATTGATTTTATATTACGTGTT
ATTTTACTTTTTTATTGTTGGGTTAAATCA
back to top