HiSeq1006 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1006
Unique NameHiSeq1006
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length238
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1006 ID=HiSeq1006|Name=HiSeq1006|organism=Ostrinia scapulalis|type=mRNA|length=238bp
GGAAGTGGGTTGAAGTCCATCACATTTGAATCTAAATACAATAAAGCTGA
CAGAATACTATGAAAAGAGTAGGGTAAGTGAGACCTATATGTCAAAACAC
ATATTATAAACAGTGTATAATACAAGCTATAAAACCAATATCTAGACACC
CAATAACTGAAATAAAAGGCTGTAATTAATTAGTAAGTACAATTAAATTT
TATTTTATTGTAGTTTGTGTGATTTGAACCTAATAGAG
back to top