HiSeq10061 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10061
Unique NameHiSeq10061
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length229
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10061 ID=HiSeq10061|Name=HiSeq10061|organism=Ostrinia scapulalis|type=mRNA|length=229bp
ACGCAGGGTGTGCGTATGTCACTGACCACGCACCCCAAGTGTTACTAGAG
AAAGAACGAAAGAATTTTTTTAGAGTGCGTTAGGATAATGATTGCACACG
GACGCTATATGGGCTAGAGACGCCACGGCGTAAGAAACATGTCACAAAAA
GTATTGGTCGTATTACATCGCGGCTCGTCGCTTTATGTCACGTTTCGTCG
CTTAACTAAGACAACGGGTGAAATGGATG
back to top