HiSeq10067 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10067
Unique NameHiSeq10067
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length807
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10067 ID=HiSeq10067|Name=HiSeq10067|organism=Ostrinia scapulalis|type=mRNA|length=807bp
TAAACGCATTTAATAGTAGTCGGTACACTTTTAAGCATTTTGTTTCGAAG
TTTTAAAACAATTTCCAACTCAATACTGGTCACAATGGTAACAGGTTCAA
AGTTCATTCACTTGGCTTCCACTTTTGGCAACTTACTCATGATGCTAGCG
TAGATTGTTTGCAATTTCTCCAGATCACTGTTAAAACGGGTCATCATAGA
TTCCACACCATCCACAAACTTATCAGTGGCTACATCTTCTTGGGCATTAG
AATCTTTGATTGCTTCGATAAGATGAGTGATAGTTACCTTTTTATTGCAT
TTTTTTCTATCGTAATCACCTCTCATAGCCTCCAGTTTCCTTTGCAAAGC
TTTTTTAGCCACACTTTTAACAGCCTCAGTAGTTTTCGGATCTATTTTAA
CTTTGCTTACATAGTGATGCTGGTAATCGTTCTCATCATCACTAAATATA
TATTTCCTCTGGAAAACTACTTGGAGAGATTTAGCATCGTCATGGTTTCC
CGACATTTTAATTATTTTCAAATTCACTCTTTGTTTGCACACATTTAAAT
TTATTGTAATTTTTAGTGTCTAATATCAACTTTTTATCATTTTAGTTCTG
ATAGAGAATTATATTTAGATAAATTCTTTAAATTGTTCTAATACAAGTCT
TGGGTTGTTGTTTGACTTAAAAATCTTTTTGACTTGTAATTTGACATTTC
ATGGATATACGTACTTAACAAAACTTTTTACTAGGTACACTGATCGTATC
GAAACATCGTATTATAATAATACAAATCTTACTTATTTATTTTATATCAC
GATATAA
back to top