HiSeq1007 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1007
Unique NameHiSeq1007
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length308
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1007 ID=HiSeq1007|Name=HiSeq1007|organism=Ostrinia scapulalis|type=mRNA|length=308bp
TCTTTTCTAAAATTTTTCCGAAGATACAAAGCTTTGATATTGGTCTGTAT
TCTTCTATACATTCACGTCTTTTATTTTTTGGGATGGGAGATACTAAAGA
CTCTTTCCATAAACTGGGGAATATCCCAGTTTGGATAGAGAAATGAAATA
AGAATGTGATGGGGATAGCGAGTTCTTTGGCACATACAGAAATGAGAAAA
GGGTGGATTCCATCAGGACCTGCACCTTTGTGAACATTTACGTGTTTTAA
TTCTTTAAAAACATTATCGTGATAAATATTGATTGAATTTATGTCCACGA
CTGTATTG
back to top