HiSeq10078 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10078
Unique NameHiSeq10078
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length219
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10078 ID=HiSeq10078|Name=HiSeq10078|organism=Ostrinia scapulalis|type=mRNA|length=219bp
AGGTTAGGTTAGACTTGCGACCTTTTCTCCGAAACTTTTAAGTTTCGGAG
AAAAAAAAGAGGCGTAATAATTAAATGATTTTGTGTAAAAAATTTTAGGC
TTAAAATTTGTGTGCCATAGACAACTAGGCGTACAAAAAATTTGGCGATT
CGATAGAGACCCCGCGTAATCGGATGATGCAATATCCTCCCCTCGTACCG
CATGTCCACGCGTATTCAT
back to top