HiSeq1008 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1008
Unique NameHiSeq1008
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length555
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1008 ID=HiSeq1008|Name=HiSeq1008|organism=Ostrinia scapulalis|type=mRNA|length=555bp
ATCGAACCCGGGACCTCTCGGCATGGTAGTCCGTTCTGAACCACTACAGT
TACACCAAACAGCCGACAAAGTTGAACTAACGGTACTCTGAACGTAAGGC
GTTCTTCTTTATTACTAAATGTATGCAAAATACGTAAGTATTTGATAATT
ATGAACGTAAATAAGAAATAATGTAGGTAAATTATTGAAATAAGCGCCTC
AATCAATGTAAAAGTTTTATACGTTGTTTACTTTGGTAGACCAGGAATCT
TGTCTTAAGAAAGCCGCTCCGAAATATGACATGCTGTCATTATATTTATT
TCCTTTTATATAAAGACTGCTAGGATTTATACTTCAGGTTTGCTATAACT
GTTGACGTTTCTGTAAGACTTTATTCCTTTAAAAAATAAATAAGTAGGTA
CCTACGTGAAAATTTAAACTTATAATTACTGACAAAATATATTCTCAAGG
GTCTTATGATATAAGAACCTCAAATCTTTCAAAGCAGGTGTATGTATAAA
AACACAAAATGTTCGTCTATTTAAAGAATTTCATTAAAACACACTGCAGA
AGATG
back to top