HiSeq10082 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10082
Unique NameHiSeq10082
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length419
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10082 ID=HiSeq10082|Name=HiSeq10082|organism=Ostrinia scapulalis|type=mRNA|length=419bp
ATTGTAATTGTCTTTTATTTATCATTTTAAAGGCACACATTGATATTACA
CTTACAAAGTACATTCGAGACTCATCTCCAGGACGGATTCGTTAACATTT
GAGGTTCTAATCGTACAGATAATTAACGAAAAAGTTATAAAAAATATTCT
TAAACTAAAATAGATATGCCTGTGTTTACTTAATATAAACAGAAATATGT
AGGTACAGTTTTTAAAGAACGCAAGATTTGTAGATAAATTCATGAATTCT
ATGAAAATTGAGATGCATTACATACTTCCATTCTAGTATTATTATTAAAC
ATTATTTAGAATTTTAGAATATCATGTTATTTTCAATAGATTCAGTATCA
AATACGCGAGATTTCTCAAACGGAAATATTGTAAGATAATTATAAGTCAT
TTGGCTGAAAACGAACGAA
back to top