HiSeq10086 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10086
Unique NameHiSeq10086
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length990
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10086 ID=HiSeq10086|Name=HiSeq10086|organism=Ostrinia scapulalis|type=mRNA|length=990bp
CAAACATCAGTCGTCAATAATTCATCATTGCATAAATTGCATTGCCTAGT
TATAAGTCTAACCAAATCTTAGATTATTCTAACCTATTTTTAATCCTTTT
TTATTTTGAATCCTTTTTTGCATGAGGGTCATGAGGACATGACATGCATG
GAGCATGACGTGATGTGAACCCGGTGACATGCCTATTGTATTGTGCCTCA
GTAGGTAATAACTAAAAGGCGAAAATAAAACCACGCATCTTCATATGACC
ATTTATTAATATAGATCTTTTACTTTACCTATAGTAAGTCATCCACTAAT
TGAGTGACAGCGCCACCTCCTTGACCCACATCCAAATTCAGCAATTTCTG
GCCAGCAATAATTAGGCTGAGCAAGTCATCACCGGTCAGTAAACCTAAAT
CAATCAAAGCGGGTTCTTGGTTGGGATTAGGTGTAGGCCTTGGATTAGGT
TTGGGAATGGTAATTACTCCACCACTTCCACCAGAACCCCCGGCTCCACC
CGCTCCTCCCGAGCCGCCAGCCCCGCCAGCCCCGCCGGCACCAGCATTCG
CCGTCGCCGCTAGCGCATTAGCTAAAGTTTTAATTGTGTCCGCCGAAGTG
GAATCGTCGCAGGGAGCGACTGCCCTTGCGAGAAGTAGCAAGGCACTCAG
GTCGTCAGGCCCGTAGCAAGGCGCAGCCAATGGATAAGGCGGAACTCCTC
TGATGGGAGCGACGCGCCCGTAGTATTGAGCTTGGGATACCTAAGAAAAA
TAAACATTTTGTTCAAATATTTCAAATGTGTTTGTCTTTTGTTTCGCATT
ACTCGTATATTACTTAGATCTTTGAACTGAACCTCTACTGTTTTCTGTTT
CTTAAATACATATAGATTCTTTCTTATCAGATTCACTTACCCCAAGAAGG
GCTAAAACAGCAAAAGAAATCAGTTGTAGCGCAGACATCTTTATGAAGGC
GACAATAGTATTCGCGTTTATTTATAGGGTATAGGGTGGA
back to top