HiSeq1011 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1011
Unique NameHiSeq1011
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length305
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1011 ID=HiSeq1011|Name=HiSeq1011|organism=Ostrinia scapulalis|type=mRNA|length=305bp
ATAAGAAAAAATTCAGTCCGCCGAGCGCATATAAGTACAGCATAGCGACG
GTGGCATTCCATGGGGAATACTCCGCATATCGAGACTTAAAGTAACCATT
TACCGATTGCAGATACGCCATGGTCGACCAAGTAATCTGGTCAGATCGCT
TCACGCGCATACTTGTTGCTACATATAATGCTTAACCTAAATAAGTAAGA
AATATTTCTTTTCATAGTGGATAATGAGGTTTCGAGACTGCGTGATTCTC
TCCAATTAAACTGTGATTGGTCGATAAGTAGCCCTATTAGCGCGTTACTT
TTTAA
back to top