HiSeq10112 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10112
Unique NameHiSeq10112
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length477
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10112 ID=HiSeq10112|Name=HiSeq10112|organism=Ostrinia scapulalis|type=mRNA|length=477bp
CGTCACAATATGTCAATGTCACCCATCCCTTGCCACTTCCATACCCCAGG
CATAGACTAAGTTAAGAGCTAGATCTATAATATGATTTGACACGTCACAA
TATGTCAATGTCACACCCTCGTGTCGCTCTCATGCTTCAGGCATTGAATG
AGCTTAGCGCTAGACCTATACTATTGATATCTACTCTGGATATCCGTTCT
CAAAGCAAACGATCAATAATAATAGATCCCAAAAATCCGTAAATATACTA
TGATATTTTTGGTCGTTTGGGTTTGCGAAATCGAAAATAATGCGTTAGGC
ACCATCTGCATCATCATCAGTTATCGACTGCCGCTCAACTCACGTCCCTG
AAGTTTGTTATTTTTTTTACTTTACATGACGCCAGTACCATATTGTAATT
TAACATTTTGGCTAGACACTGATTATTTCTTTTGTAAACTTTCAAGTGTT
TTTCAGAAACCAGTCAAATAGCCTATT
back to top