HiSeq10114 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10114
Unique NameHiSeq10114
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length620
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10114 ID=HiSeq10114|Name=HiSeq10114|organism=Ostrinia scapulalis|type=mRNA|length=620bp
GTTTTTATTATCTTAATTACATAATTTTGGTGTGATTTATTACATATTAT
TCAAGTTCAAATTAGAACACTTATGCTACGCTCACTGAAATACAGTTCAG
ACCAGTTTCAAGTTACAAATGAAACTCAAGTCAAGTCACATATCTCTTGC
TCTGAAACCTGATGACCAATCATCAACAATTTGGTTTTTAAACCCTCATA
TATTTTCCATTAAACACCATAAGACGTGGCGGAGGATGGGTATGGATCCC
TGATGGTTCTCCGATCACTGTCATTTTCGGATCTAAGTAAATAGCCACAT
AGCATCTACTGGTGTTGCTACAAAACCACCTGGCTTGGTTGGCTTTCCCA
CTTCTCTTTGTGTACAAGTACCCTCCGTACAGAAACAACTTTTTGCCATT
TGTAAACTCGACTAGCTGCCCTGGGGACAATAGAGTCAAGTCAAATATGT
TCTATCAGAAGGTACATGGTCAAGGACTCAATTACTTTCAGATGCTTAAC
TACGACGATGTATATGTTCCTCCTCCTGTTATACGATCTCAACATAGTAT
AGAATAAATAGGTCTTACAATTTATTAAAATTAATACAAAACAACTTATT
ATACAACATTACGAAAGTCC
back to top