HiSeq10115 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10115
Unique NameHiSeq10115
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length552
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10115 ID=HiSeq10115|Name=HiSeq10115|organism=Ostrinia scapulalis|type=mRNA|length=552bp
ATTGCAGCATAGGCTGTTCTCATTGAATTGTGGGTGGAAAAATCTTCACA
CAATCTAATCTTCATTCACTTGAATCTCACGAGCTATAGACAGAGTTGGC
CGTGATGTGACCTTCATATCCTCAGATATTTCCCATCGTTAGTCATATGG
AGATTGGGCGGAAGATGGGCGTGAAACCCTAGTGGTCCTTCCACCACATT
CAAGTCTTGATCCAAGTAAACAGTGGCAGAGCACCTGCCAGTAGAGCTAC
AAGTCCATCTGACCTTGAAAGGGTTCTTCCCTGGCCGCTTTGTGTACAAG
TACCCTTCGCACAAAAACAACTTTTTGCCATTTGTAAACTCGACTAGCTG
CCCTGGGGACAATAGAGTCAAGTCAAATATGTTCTATCAGAAGGTACATG
GTCAAGGACTCAATTACTTTCAGATGCTTAACTACGACGATGTATATGTT
CCTCCTCCTGTTATACGATCTCAACATAGTATAGAATAAATAGGTCTTAC
AATTTATTAAAATTAATACAAAACAACTTATTATACAACATTACGAAAGT
CC
back to top