HiSeq10119 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10119
Unique NameHiSeq10119
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length352
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10119 ID=HiSeq10119|Name=HiSeq10119|organism=Ostrinia scapulalis|type=mRNA|length=352bp
TTAATTTTTAAGTGACCCCTATGGAATTTTGTTTTCAAAGGGGTAACTTA
AAAATTGGGGTGAAAACGCATTAGATTAGCTAATGGAGCAGAATATTTCT
TTACACAGCCAACATTCCTAACTTAACTGTTAAAAAACTTATCTTTCATA
ATACATACTCTTAGAAAAAGGATCGAATCATGAAATGAAACCCAAAATTT
ATACATTTCAAATATTACATTAGTTTAATTTCAATATTTGGCGCTTTCAC
AGGCCAGAATCTATTGTAACTTCATAATGGCAATAAGTTGAAAAAAATAC
AATATTGTACACTATCTTTGTCCAGAAATGGACGTCATTTGGCTGAAACA
AA
back to top