HiSeq10120 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10120
Unique NameHiSeq10120
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length303
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10120 ID=HiSeq10120|Name=HiSeq10120|organism=Ostrinia scapulalis|type=mRNA|length=303bp
TTTCAAAGGGGTCACTTAAAAATTGGGGTGAAAACCCATTAGATCAGCTA
ATGGAGCAGAATATTTCTTTACACAGCCAACATTCCTAACTTAACTGTTA
AAAAACTTATCTTTCATAATACATACTCTTAGAAAAAGGATCGAATCATG
AAATGAAACCCAAAATTTATACATTTCAAGCTTGACATTAGTTTAATTTC
AATATTTGGCGCTTTCACAGGCCAGAATCTATTGTAACTTCATAATGGCA
ATAAGTTGAAAAAAATACAATATTGTACACCAGGGTACGGAAACTTCCAT
ACT
back to top