HiSeq10123 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10123
Unique NameHiSeq10123
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length516
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10123 ID=HiSeq10123|Name=HiSeq10123|organism=Ostrinia scapulalis|type=mRNA|length=516bp
TAGTAAATTTAGGCCGGATATCCTACCTACCGGATAGTTACCGGATATCT
GTTTCATCTCTAATCTGTATCATCACACCAATTATTTATTCATTATAATT
AATATCTTTGTTATGTCCTAACAGAAAAATTACCACACCCTTTTACTAAC
TCGGAATTTAAGAATGAAATTGCAAGTTGGTTAAAAAATTTACTTCTTCA
TGACTTCATCGGCGCGCCGATGAAAAGCCATTATTTTCATGGAAATATCG
TGAAAAAATCGTGAATCTCTCAATTCCATAGATAAGCATCTTACTAATGA
CAAGCGTGTGGTGGTTTGAAGTACATAAGTGTATTTGTGTGCTGTGTAAG
TAATTTTACTTGCTGCAGTCTCCACAAAGTGGATTGTTTTTAATCGTGAC
CTTTTAGTGACGAAAATAAATGTATCCTAGATGTTTTAGTTTGTAATAGT
GTAGAAATAGATATAAAAATAGAATGTATGTGTAAAATATGATATAAATA
AAAATTCGTTTTATTG
back to top