HiSeq10125 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10125
Unique NameHiSeq10125
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length328
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10125 ID=HiSeq10125|Name=HiSeq10125|organism=Ostrinia scapulalis|type=mRNA|length=328bp
GATATGATGATGATGATGATGATGGTGAATACGGGCAGAGGTGTAGGTAT
AAATAAGACCAAAATGTAGGCTTTTTCATGTGCTATATTTGATAATAATA
GAACATTAATAAGATTAACTATTACGATAGCCGTTACATTTCTAATGAAA
TTCATACAAAAATATGCCAATAATATAATTGGACGTGAAAGAGTATATTT
TTAATTTAAAAATAACACATATACACAAAAGGCTGTGGCAGTTTTTAAAG
CTAGCTTGCCGATTGTACAGTCAGCGTTAAATATTTCGTGACACCCAAAG
TGAACAATAAGTTCGAAACACGTCTTTG
back to top