HiSeq10131 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10131
Unique NameHiSeq10131
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length559
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10131 ID=HiSeq10131|Name=HiSeq10131|organism=Ostrinia scapulalis|type=mRNA|length=559bp
AATCAGGGAAAATCGTATGTGAGTGAAAGGAACAAACTGGTTCCTGAAAG
ACGATTGAAATCCCCATGTGGAGATCAATGCAGATTGAAATGCAAAGAAA
ACATTACAGAATTACAGAGACAAAAGTTATTTCAAAACTACTGGGAAATT
GGTGACTTGAAACTACAGCGAGAATATGTTAAACAGCACATTTCAGAAAT
TAAGCCGAAATACTCGTACAAAATACACAACAGTAATCGGGGAAACAAAT
TTTCTTTCTATTTTACGGTAGGAAATAAAAAAATTAGAGTGTGCAAAACT
TTCTTCAAAGCCACTCTTGATATCACTGACAGGCCTATCAGGACTGTAAT
CCAAAAAACCAAAGACACGGGAAATTTAGAAGATCGACGAGGAAGACACA
AAAAACCACGCTTATAATTCAAATTGTTACGAATTCGTCATAAAAGGGCA
CACTCAAAATGAGGGCGATAGTGTTCACTCTATTATACCTTGAAGCCTTG
GAGTGATATACAGATCATTACTACACACAGACAACAGGGGCGGAGCAGTA
AAGAAAAAT
back to top