HiSeq10132 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10132
Unique NameHiSeq10132
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length203
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10132 ID=HiSeq10132|Name=HiSeq10132|organism=Ostrinia scapulalis|type=mRNA|length=203bp
CACATTTCAAGTCAACATATCACTGTCATTACTTGATTTAAAAAAAAGTT
CCCATTATTTTTTATTACCTTTCTGACGGACTAAATAGAATTTCTATTTC
ATTACCAAGACATCATCAGTTCAGGGTGGATTCAACCAAACAAGAGAAAA
TGAATATTAATCTCAGAATAATAATACGAGTATTTCCCATACTGAAACTG
TCA
back to top