HiSeq10135 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10135
Unique NameHiSeq10135
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length206
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10135 ID=HiSeq10135|Name=HiSeq10135|organism=Ostrinia scapulalis|type=mRNA|length=206bp
GATCGAGATTTTTCTTCCAAATAAACAATGCAGATACTGCAAACGCATTT
TTTATAATTAATTGATTATTGTCTGTGTGCGTAGATTTTATAGAAAAAAC
GTTCACAGAGTACAAATGGGCTGCCTTTAATATTAATATAAACGAAACCA
GTTTCTGTCCTTAATTTATGAATAAATCAATGTTTTAAAACGAAAAAAAA
GTCGTA
back to top