HiSeq10136 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10136
Unique NameHiSeq10136
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length2462
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10136 ID=HiSeq10136|Name=HiSeq10136|organism=Ostrinia scapulalis|type=mRNA|length=2462bp
AAGATAAATCTTATTTCATCCGATAACAGACAATACCAGTGATGTATAAG
ATACCCAATATAAAGTATCTGAAATACAAGATGCAAGATACTTTAAAAAA
AAGCATTTCAGATACCAGATACAAATAATTTTCTAAAAAGGTATCTGAAA
TACTAGATACAAAATACCTATCTTTCAAATACTTTTTAAAGATAAAATAC
TTTTGTAAGAAAACAACATTTAATTGAACTTATCTAAGTTTATTCGTTCG
AGAAAACAATTTTCGAATAGATCGCGTTGATAACAAGGATCAGGCAAATG
TAACAAGACAAAATATGAAGGTATTAAAATAGAGACTCATAATTTTAATG
CTTTAGTTGAGATTTGAGTAAAAGTAATTCCTCAAACATATTGTCAGTCA
TCTTCCTTCGATGAGGCCTCATGATCATGCCCCCAAAGGAAAAGAGTCGC
TCCACAGGGGCAGAGCTGGGCAAACAGGTGTTATATTTTAGGAATATTTT
TTTTACTGTAGGATAAGCATTTAAGCTCTTAAAGTTTGCATCTTTATTGT
TGAGGTACTGGAGTGTCTCTAAATCACTGGTGCTGCTTGTGTTTTCGCCA
CTAGCAATAGAGGAATCGGAGTCCTCTAGAAACATATAATAAGATTCATC
TTTTGTCTTTTTTTTTATTTCACCTTCAATGTTGTTTAAAGCCTCCGATT
TTTGTTTTTCAGATCGATTGATCTTTCTTGTTTCAGACAGAAAAAGTTCT
TTTACATATTCCTTTCGCGCTTTTGGTACCCATTTTAATTTAAACATGGG
ATGGGACACTGAGGCTAATATAGCATCGTTTGCTGCTGGTTCCAACTGCA
AAAACCGTTTAAACCGTCTCTCTAGGTTTTCTTCTAATACATCAAGCAGA
GGGCTGCAGTATTTCAGATTTTCCGTTCTGAGGCTTTTGATAACATGTTG
GATTCTGTATAATTCCGGTAACAGACAGCCATAATAAGTATCTTTTTCCC
CTTGCAGGCTTTGTATAGCTTCTGCTATTGGCTTTGAACAATCCACATAT
TCACTTAAAAAGTGAATTTCATTTTCTTTCAGCTGTGGTAACTTTAACAT
TTTCAAGGCTTCACTCAAACGGTTCTGTACAGCTAAAAGATCTTGTATAG
AATTATAGTAGGAGTTCCATCGAGTTGCACATGGAGAAGTTGGTGACTTC
CCTGTTATTTCTAAATATATCTCGCATGCCTTTGGGGATCTAGCACACAA
GTTCCACAGTGCTTGGCACTTTGATAAGGCTGTGTCATGTAGTTTCTTAT
AAAATGTATTTTTGGTTCTTGCTTGTTTGAAATCAGTACTAGCAATCAGG
TGTAAAGTGTGTGTAGCACATCTTTCATGTCCGGGCAGAAGGCAATCACC
TTCTAAGTCTGATGAAGCATCTGGAAAAGCTTGTAGTACTAGAAGTGAAT
CATCATCTTCACTACCTTCATCAAGTGATGTTTTTTCAAGATCTCCAAAT
GCATGTGAAACATGTTCATTTAGAACTACCTCTGAATCAGACTTTCCAAA
TACCTCAAAAGCCTTAACCATGTTTGAGCCGTTATCTGTAACCGTTTTAA
CAATTTTTGATAGTTTCAGATTATAGTCTGAATGTATATCAGCTATCATT
TCAGCAACTTTATCATATGTGTGAGCCCCCTTGAATCTTCTGCAAGCAAT
TGCAGCACTTTTCCTTTCAAACATCTCACTTTCAATCCAATGGACTGTAA
CCCCCAAGTAACTTCTTTTAGATGAAGACCAAATATCAGCTGTACTGCAC
ACAAATTCGACGTTGTCCAACTCTAGCTTAAGGTTTTTCTTAAATTCATT
GTACTCATTACTAATTTTATTCTTAGCTGTATTACGACACATAACCTTTG
GAGGCTTAGTTAGTTGCTGTGAACCTTCAATTAAAGCTTTAAAATACTTA
TTCTCCACTATTGATACTGGTGACATGGTGTCAACAATAAATTGTACAAT
CAACTTGTCCAAATTAACAGATCTTGAACCGCTTACATCTGTAAGAAGAG
ACTGCTTCAATTTTTTACATGTTGATTCTGAACCACTTGCACCACTGTTA
CTAATCTCAGTAAGTTTTCTTTTTTTAAGAGTTGTGTTTTTAACATTTTC
ATAATCTTGCAATAGATCTGAGTGGCCTTTAATCTTTAAATGCTTCAGGA
AATTTGTAGTAGAAGTAACACTACCCTTTATCGTTTTTGAACATACATTG
CACACTGCAGATACATTCACATCACTTCCATCCACTTGCTTAATATCTTT
GAAGCAGTACTTTAAAATGAGTGGTATACTCAACTTGTTCTCTTTATCCG
TTTCCATGTTCGCGATCCCGAATCCCACAAAGGCGATATTGTTATTTATT
ATTTAATTTAAAACACCATACCTACAACATGTGCACACGAAAAAATTACG
GAATGAGTGACA
back to top