HiSeq10138 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10138
Unique NameHiSeq10138
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length782
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10138 ID=HiSeq10138|Name=HiSeq10138|organism=Ostrinia scapulalis|type=mRNA|length=782bp
TTGAAGTAAGATGGTGCAACCCAGTACTTTTTTAAGTCAAATTTTCTTGC
CGGTACTGGTACTACTAACTGCCTAAACTCCCATAACTAACCATGGTCAG
AGAATGACAGCAACCCAACTTATTAAAATGCCGGCACAATAATTGAACTA
CTGAATCTCGAATCAGAGTTAAATCACTTTTATGGCAAGATGAAAAAATA
GTGCTCTATAAATTTCGATATTAAAATCCCATTGTGATGACCATGAATGT
TTGAACCGTATTATATTTATTTGCATTCGCCACTCGCGTGTTACACGCAC
AAGTATTTAGGCGTATGTACTTAAGAATTTTAGATGTATATTGTACATTA
CCTATGTGAAGGAAAATGACAAACAATCAGCATATTAGGGTAAAAAAGTA
GTGGCAAAGTTTAAAGAGGGTATAAAAAGTAGTGGAAAAGTTTGAAGATT
CGTAATGAGTCGTAGAACTTATAATATTAAGATTATTTTTAAGAATGAAT
GATTGTGGGTATGAGTGTTTCACGGTTACATGATATCACTGCAGTTAAAC
GTAGTGTCTGTCATTTCTTTTAGTAGTGTACAGGCGATAGCAAATACTTA
CTACTTGCACAATTTTGTAGCAAAATTGCCTTTATCATAACCAACATAAG
GTCTGTATAAAGTATCCGTAAGTTGCCTGTACTTCAACACAAGGGGAAAT
TTCAAAATATGTTGTGGGGTTGATGGAAGTAAAGAGCAGTTCTGGTTTAC
AAAGAGTAAAGGTACAAGTCCAAGATGGACTG
back to top