HiSeq10139 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10139
Unique NameHiSeq10139
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length966
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10139 ID=HiSeq10139|Name=HiSeq10139|organism=Ostrinia scapulalis|type=mRNA|length=966bp
TTGAAGTAAGATGGTGCAACCCAGTACTTTTTTAAGTCAAATTTTCTTGC
CGGTACTGGTACTACTAACTGCCTAAACTCCCATAACTAACCATGGTCAG
AGAATGACAGCAACCCAACTTATTAAAATGCCGGCACAATAATTGAACTA
CTGAATCTCGAATCAGAGTTAAATCACTTTTATGGCAAGATGAAAAAATA
GTGCTCTATAAATTTCGATATTAAAATCCCATTGTGATGACCATGAATGT
TTGAACCGTATTATATTTATTTGCATTCGCCACTCGCGTGTTACACGCAC
AAGTATTTAGGCGTATGTACTTAAGAATTTTAGATGTATATTGTACATTA
CCTATGTGAAGGAAAATGACAAACAATCAGCATATTAGGGTAAAAAAGTA
GTGGCAAAGTTTAAAGAGGGTATAAAAAGTAGTGGAAAAGTTTGAAGATT
CGTAATGAGTCGTAGAACTTATAATATTAAGATTATTTTTAAGAATGAAT
GATTGTGGGTATGAGTGTTTCACGATTGCATGATATCACTGCAGTTAAAC
GTAGTGTCTGTCATTTCTTTTATCAATGTAATTAGACGTTGGTGTACAGA
CGATAGCAAATACTTACTACACAATTTTGTTGCAAAATTGACTCTATCAT
AACCAACATAAGATCTCATGGTATTTAGCTGGTCGTGCCGTTGTCTGTCA
ACAAAAGGGGAAATTTCAAAAGAATGTTGTGGGGTGGATGGAAGTAAAGG
TCTGTAGTTCTGGTTTAAAAAGAGTATAAAGGTTGTCGCTTACTGTCACG
GCAGCAGTCGTAGAAAAAAGAAATCGTTACTGTCTACGACATTCAGTCAT
GAAGATCAATGACGTATAGGAATCCAAGAAAATCGGGAATCCTTAACTAC
CGTAGGGAAAAGGAAGCATTGTAGGGTTAATGCAAGTAAAGAGGTGCAGT
TCATTTACAAAAATAG
back to top