HiSeq10148 (mRNA) Ostrinia scapulalis

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameHiSeq10148
Unique NameHiSeq10148
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length1121
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Relationships

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
HiSeq10148HiSeq10148_pOstrinia scapulalispolypeptide?


Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10148 ID=HiSeq10148|Name=HiSeq10148|organism=Ostrinia scapulalis|type=mRNA|length=1121bp
AAGTCATGTTAATACGTCACTTTGGCGTACATGTCTCAAGAGGCGGATTT
GTGAATGCATGCCATAAGCTCAGCTCAGCGCAGTTATTTTTATGACCGAC
TTTTAGGCGTACGGGTACCGATCATACGCTATCCCAACGCTTTCAGCACT
TTACGGACCGCAGCCTGAATGTGACGGGTTGTTGTGCTATCTGTCACTTC
TGTCAGTGTATAGTGTCAAATGAAATGTCAATTTCTTTCATATCTTCCTT
TCTGTACCTGTGACAAAAATTATTCTTTCCTTTCGAAAAAGAAATTAAAC
AATAATTTAATTGATGTGTTTGTAAGCCTAAAGTGTAGTTTTATAAAGTA
GTAAATCATAAAATGGGTGGTCTGTTTGGTAAACACAAAAAAACAAGTGA
GCAGAGTGACTGAACAAGATAAAGCTGTTTTACAGCTCAAACAACAGAGA
GATAAGTTAAAACAGTACCAAAAACGAATAGAAACCAATCTTGAGAAGGA
TAGGCTGCTGGCCAAAAAACTTCTTAATGAAGGCAAAAGAGACAGAGCTA
AACTATTGCTAAGAAAAAAGAAATACCAGGAACAATTACTACAGAACACT
GATACGCAATTAGAAAAATTAGAACAGCTTACTCATGATATAGAATTTGC
GCAAATCGAAATACAGGTATTAGATGGATTGAAGACCGGTAATGTTGCGT
TGAAGAAGGTTCATGATATACTCAGCATAGATGAAATTGAAAAAATAATG
GATGAAACTAAAGAAGGCATTGAAAAACAGAGAGAGATAGATGAAATGAT
TTCTGGCCAGTTGACGGAAGAAGATGAAGAGGAGGTTGAAGCAGAACTTG
AAGCCATTCTCGATGTCAAAGATGAGCTACCTGATGTGCCTACAGACAAG
TTACCAGAGGTGGACAAAGAAAAGGTGCCAGAGAAGCCGCGTAAAACAAA
AGAAAGTCCATCCAAGATTGCAGTCGAAGCCTAGAGAAAATGTTAAATAT
TTTTTATCAACAGTCCTGTCAGTGATTTGACTGTCTGCAGTGATTTATAT
TTTCCTTTTTGTGCTATAATTATATTACTGTACATAAATTAATTTAACTC
ATAAGTAAAGCATTATATATT
back to top

protein sequence of HiSeq10148

>HiSeq10148_p ID=HiSeq10148_p|Name=HiSeq10148|organism=Ostrinia scapulalis|type=polypeptide|length=207bp
MGGLFXXNTKKQVSRVTEQDKAVLQLKQQRDKLKQYQKRIETNLEKDRLL
AKKLLNEGKRDRAKLLLRKKKYQEQLLQNTDTQLEKLEQLTHDIEFAQIE
IQVLDGLKTGNVALKKVHDILSIDEIEKIMDETKEGIEKQREIDEMISGQ
LTEEDEEEVEAELEAILDVKDELPDVPTDKLPEVDKEKVPEKPRKTKESP
SKIAVEA
back to top