HiSeq1015 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1015
Unique NameHiSeq1015
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length233
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1015 ID=HiSeq1015|Name=HiSeq1015|organism=Ostrinia scapulalis|type=mRNA|length=233bp
GAAGACTAAATAGACTCCAGAGGATTACAAAGACTCCAGAGGACTGAAAA
TACTCAAGGGGATATAAGGATTCCAGAGGGCTGTAAAGACTCCAGAAGAA
TGTAAGGACTCCAGAAGAGCGTTGCCTCCAAAGGTCTGACAAGACTCTGA
GAACTGAAAAGATTCAGGACTGGAAGGACTTAGAGGACTATGAAGATTCC
AGAGGGTTATAAAGGCTCCAGAGGACTGAAGAT
back to top