HiSeq10158 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10158
Unique NameHiSeq10158
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length304
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10158 ID=HiSeq10158|Name=HiSeq10158|organism=Ostrinia scapulalis|type=mRNA|length=304bp
ATTGTATGAATTTTCAGAACAAAAGCTATGTTAGATTTCACAGATTATTA
TCATAGCGAAACCATAGATAATATCGTCGCCATTTGTAAAACTTCATAGC
GTTTATTTTTAAAAGTGTAAGCTTTAAAAAGACATTTCCAAATAATAAGA
TGCATAAGTTATAAGTTCGTGGTTTTGCTAATCGTACATTTTATTAAATG
TATATGAACAATGTTACTCCTATTGTTTAATATTATATCATTTTAAAAAC
CCTCATTAATGTTAACAAAAAATACTACATCATCACATCAGTAATTAGTC
AATA
back to top