HiSeq10161 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10161
Unique NameHiSeq10161
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length1414
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10161 ID=HiSeq10161|Name=HiSeq10161|organism=Ostrinia scapulalis|type=mRNA|length=1414bp
ACTTTGCTGCTTTGCGAAACTAATCAGGGTAAAGTTTAATAAGTAAAATG
ATAAGAAAACGGTTTACGTAAAAAATATCAAGTATATTTCAGTAAACAAC
ACAGCATAATGACTTACTCGTAATTATCTACATCAACATGTAAATAAATC
TTATTGTGTAGCTAAAAGTGAATTAAAGGATTTATTTAGATCTATAAAAT
AAATTACTTAACGCATTTACTAGGCGAATACATAATATTAGGACAAATAC
AATAAGAAGACATTATCGTTATGTATTACAGTAATTAAAATATAGACATT
TCACAGATGATACTACAAAATAACAATATTTAGCATATTTCAAAGGTTTT
TGGCCTAAGGTAGATGTAGTTTGAACGCCATTCGCTGCTTCAATTCATAT
CTAACCCATGTACCTGGAATAGAAATTTATATTTTTTATTTTCATGTATG
GTGAGTATTATAAACGTTTGAGTGTTGGTTTTGAATCTCGGCGAGGAAAA
ACATGAGCGTAATTTATTAGGCGTTTTTCCTGCGGCGACAGATAGAGGCA
AAAATTATACGATAGTCATAATAATAACAGATGTATCGTGGAAACACACG
GGGCATGGGGCAATCCGATTTGCATTTTACTACGAAATCACATCCGTTTG
TACTTAGCAAGGCTTCGTCGAGGCTATGACACGCCTTAAGAAAAACGCCC
TATAAATTAATGAAGTTAGTATTTAGATCCAGAGTTCATTTTAGGAAATA
AAATTAAATCTGCGCTTGCTCACTAAAATTTGAGCATCAAAATTAGGTAG
GTACCGCGTGTTCAGGTACGGTAATTATTTTCTTAAAAGAACTCTGGAAG
AAAGACTTGAAATAGGTAGAAAATAATCAGTTCCTATGTTAAGTTCTAAA
ATTGTATGTACAGTTGATAACATTTTATAACCGTAAGTAAGATAAGAAGC
TGGAAGGTAACTATTTTTTACTTTAATCGCATGATTATTAATTGACTTCC
CTACCAGATCGTTCAATAACATAATTATTAACTCTTATTAACAATGCTTT
ACTCGTAGTCAATCATTATTATCTAGTTTAACGAATGGTTCTCTCATGAC
GTAAGTAGGTAGGTACTATTTCTAATAGATGACAACCTTGTCTAGTTAGT
AGGTACCTATTGAAACACTCAAAGTGAATGAAGTTCCTATTATTTGCATA
ACATACAAGTTAAGTCACGATAAATATCACGACATTCAGCCCATACATAA
ATAAATCAAATATACGATCAACCTATCTATCTACATTTAAATCGTCTTTT
GTAATTAGTCATTCATCGCGAAATCAGGCCAAGTAGATAAACTTAATTTT
CTATATCTAGATTTTTTAAAACCACTAACATGTTTCCTGTTCCCGGGACA
AACTTGGCCTTCAC
back to top