HiSeq10166 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10166
Unique NameHiSeq10166
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length1063
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10166 ID=HiSeq10166|Name=HiSeq10166|organism=Ostrinia scapulalis|type=mRNA|length=1063bp
GCTAAAGTCGGAGATTTGAAAATGGTAAGATTTACTATTAATATACTTGT
AATCAATCATGCAAACGGCTCAGCTTAGTGTTATGTTAATAAAACCTGGG
AGACTGTGAATAAGTTTTCTTATTCTAAAGCCAAAAGAATCAAACTACTT
ATTTCATGTCTCAATGTTTTGATCGATCGGCAAATCTTAACTTCACAGAC
AACATCAAGTTTTCATTACTAACTAGTTAGTATTACTAATTAGGTCTTAC
GGAAAAGTTACGTCGCAAATCTATAAGTAAGGTGGGATAGATAAATCTAG
CAACAAAACCGTTTGCAAGCCTTACAACATTCTAATACTTACTTATCGTT
GTTATACAATATCCAACGTCTATCTTTAAGGATACAATGTACCGGAAAGT
GAAGTACGTCATTATTATCTGCTTTAAATCCTTATCAATGGATATTCATC
AGCATTAGTCATTTCAAAATCTACACCTATATCTTACACATCATCCGCTC
AGTATTAGTCAGATAGGAGATTCGTTTGAAATCAATTTTGCAAGAAAAAT
GTTTCTTGATTTACCTTATTTTACAGAAGCCTATCTTATCTTTTACGAGT
TACCAAGATTACCAAGTGGATAACATCCTTAAGATAAAGCTGATATTAAG
AAGATTTTCCTTACCTTAAAAAATATGAAAATTCGTTGAAAGAAAGGTTA
CATATCAAATCTAGATCTGTCCCTTTTCATAGAAAAATGTAACACTTGTT
TGTTTTCTTATAGTCATGTCCGTAGTAAGCCTAGGCTGATCTTAAAAAGT
ATTCACAAAGTTTTGATAGGAGTTTTCTAAAAAGTCATGATATTTTGTAC
CAATTATTATTAGTGTAATTACAATAAAAGAGTCCCGTCATTTTTAACTC
TCGTTATGCAGCCTGTACGTTTGGAAATATTTTTTAATTATTAATTTGCA
AAAAAATATGGGTAAGTAATAAGTATGCCAGTGAGAGTCGCTAACTACGA
AAAACGTGAGGCAAATACGTTATGTTTGATAATCGCCTTAAATATACAGG
GTGGAAACGATAA
back to top