HiSeq10169 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10169
Unique NameHiSeq10169
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length415
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10169 ID=HiSeq10169|Name=HiSeq10169|organism=Ostrinia scapulalis|type=mRNA|length=415bp
GGTGGTGTTAGGGCTGGTATCGTTAGTTTATGGAATCATGAGCGATTGTG
AACTACCGAAAGATAAAGGGTCATGTGATGGGCGGTATCGGAGGTAATTA
AAAATAATGCAGCTTGCTTTATTTCTTGTTTAAATAACATTCTTAAATAT
ACAACACCAAGAGATCAGTACAGTTCAAGCTAAGTAGTCCATAACAAAAA
CGAGCTATTTTAATCGTAGTTACGCCTGATAGTATACATTAGCAAAGTTT
CTTAGAGATCATTTTGTTGCGGTAATTGCTGCAATAGGCGTTCACGCCGG
ATGAATACTGTTAGTTATACCAGTTATACGTGTTAACCGTAAAACGAATT
AATCTAAATTGAACACTTACAAATTACTTGTATTATCTATATTAAATAAA
TTAATAAGTAAACCA
back to top