HiSeq1017 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq1017
Unique NameHiSeq1017
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length213
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq1017 ID=HiSeq1017|Name=HiSeq1017|organism=Ostrinia scapulalis|type=mRNA|length=213bp
GCGCTCAAGCTCTTCTTATTCAGGTAAATATTTTGACTAGAAAAAGAAAA
GTTTTTTAAAAATATTGATCCCCTACAAAATCCTAAATACGATTGACTTT
TGAAAACATACAAAGTAAACTCTTGGCCTGCGTCTCACCTGATGGAAAAT
AGTAACCAGGCCTATGGTGGAAACGAGCTTCACCTGGAGTCCTCAACCAC
AGAGGAACTGGCT
back to top