HiSeq10172 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10172
Unique NameHiSeq10172
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length216
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10172 ID=HiSeq10172|Name=HiSeq10172|organism=Ostrinia scapulalis|type=mRNA|length=216bp
AGGAAATTTGTTACTGCAAGACAATTCACCCGCGTACACCGCGCATGTTG
CATGGCTTGCCCCAGGTAAAATTGGATTTCAAGAAATTAATCACCCACCA
CACAGTTTAGTCCGATTCTCTAGCTATTTTGTCTAATTCTCAAATTGGAA
AAAAGACCTCCAGGAACGAAGATTTTCGAGTGACAAAGAAAGGAAGGCGG
CGTTAAAGGCTCATTT
back to top