HiSeq10175 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq10175
Unique NameHiSeq10175
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length507
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq10175 ID=HiSeq10175|Name=HiSeq10175|organism=Ostrinia scapulalis|type=mRNA|length=507bp
TACCCATTTACCTAACTCCCTGTATACAATATCTGCGCTAACGCCTCAAT
TTTCATTGAGCGACCTATAACATGTTACTGTAGAGTCCAATTAGTTAAAT
GATAAATCCGTAGAAATAAACAACAAATAACTTTAAATCTGCTAGAAGTC
CTGCCAGAGTAGGTGTTTTTATATTTATTTAGTATCTTTGCCGAGTTTAG
CACAAGATAAACCGTAAAATGACAAAATAAAATATAAGTTTATGTGAAAA
TTTCAGCGAATTTTAGTTACCAAAAATCCTGTCTATTTTTTTACCTTCAT
AGATATGATACTTCTGTACCTATGTTTTGTGATTGTCTTTATTCTGTGGC
ATTTTGTGCACTCAAGTACATTTTGTATGTAAATAATCGATTTACACGAT
TTTCTTTACTTATATTTATTTATTTATTGCGATTGTATGGTCGTGTGTTG
AGAATAAAATTGTTATTATTATATTCGTTGTTTTCTTATTCAAAACTGTC
CACCTTA
back to top