HiSeq23 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq23
Unique NameHiSeq23
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length210
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq23 ID=HiSeq23|Name=HiSeq23|organism=Ostrinia scapulalis|type=mRNA|length=210bp
GTGCGCGCCATTGGGTTTTTAATTGTATTGCTAGATCGTGATATTTAGTA
ATTTTTCCGGAAATGGTTGCTTGGATATTATGCGAGTTGGGGATTGCTAT
GTCTATTAAGTAAACTGTGCTATTCGTTTTGTCGTGGAATGTAATATCTG
GTCTATTGAAATGTATCGTTTTATCAGTAAATAGTGTCCTGTCCCAATAC
AGCTTAAATT
back to top