HiSeq28 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq28
Unique NameHiSeq28
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length252
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq28 ID=HiSeq28|Name=HiSeq28|organism=Ostrinia scapulalis|type=mRNA|length=252bp
GTTAATTACTGTTTTCTTTTTTAAAAAACAAAATGTCAATTTATTTTATT
GTGGCAGATGTTATTGATTGTCTGGTCAGCCAATATTTTTACGATCGTCG
TTTATTTCGAGACAAATCAACATGGCTGATTGAGAATCAATTTAGATGGC
CAGCACCAATTTCGTCTATTTTCAGTTTCATAATTTACGTTCTTGTTTAT
GTGAATTATTCTTGCTCATAAAACGCTTTATTATCTACTTTCGGTACCTA
CA
back to top