HiSeq29 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq29
Unique NameHiSeq29
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length251
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq29 ID=HiSeq29|Name=HiSeq29|organism=Ostrinia scapulalis|type=mRNA|length=251bp
GCTTAGGCAAAGGAGACTAAACAGAATTGCGGCGGGCGCGAGACGAATCA
CAGGCGCGCTCTATAAAAAGTCTGTTTACGCGACCGCCGGATATGACCGG
GCTGTGGTGCGCCACATGTGTAATGGTCATCGTTTACTTTTCTCTACAGC
TCCTTACTACTTAATCGAAGCCTACAGCTGCCATGTGTTTCCGTGTTTTA
AGAGTTTACATTTTATTCCCTTTAAGTAAATTTTTTAGAAATTCTAAAAA
T
back to top