HiSeq32 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq32
Unique NameHiSeq32
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length213
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq32 ID=HiSeq32|Name=HiSeq32|organism=Ostrinia scapulalis|type=mRNA|length=213bp
ATTTCTTTGTACATTTCTTCCGTCGCACAATATATTTCGCAAAACGATTT
TCCTTGGGAATCAAAGTCTTTCACAATCTTACAAATTAAAGGTAAAAACG
GTTTAATGAGCTCATAATTTTATACATTTCTACCACACATAGGGTTGCCA
GTGGTTGTTTTGCTTTTTACGGAAATTGTCCGGCCAAATACTGTCTTGTC
CGGCCTTTTTTGG
back to top