HiSeq34 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq34
Unique NameHiSeq34
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length217
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq34 ID=HiSeq34|Name=HiSeq34|organism=Ostrinia scapulalis|type=mRNA|length=217bp
AACAACTAGTATGCAGAAGCTACATTGTTAGCAGCTATAAAATTAATCAA
AAAACAATTAGTACTATTTAAAGTCTGAAAACTAATATTCTAAAATCAAT
GCCAAGTTTCAAAGATTTAGGTACTCGTATTTATTAGTTAATTACGGCAT
TTACGGATAGTCAGACATGTTAGTAACTTCTGCCATATTATAATGCCAAA
ATATTTAAATTTCATAT
back to top