HiSeq39 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq39
Unique NameHiSeq39
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length255
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq39 ID=HiSeq39|Name=HiSeq39|organism=Ostrinia scapulalis|type=mRNA|length=255bp
TGACATCCAAACTTTCGCATTTAAGTAGGATTTGTGAATTTAAAATTGAA
TTCAGCAATATTGGATTCCCAATTAAAGCATCAATTACAGCTATTGTCAC
CAACCTGATTGTTTTCAAGCACATTATTTTCACGTTTATACTTTCATTGG
CCGTTCAAAGTTATTAATATGTTTAATCAAACGGTAATTACGTTCATTGT
GCTGTTAATGATTCAGGTACAGTTAGCGTCAAAAAGTGCGCGACATCAAA
AGCGG
back to top